Adult Onset Still's Disease

And the vaccine DNA is Still there, yet no adults are to be found

Anadamigo Jonathan Gilthorpe sent me a treasure trove of sequencing projects that have hit the Vaxxed vs UnVaxxed with RNA-Seq. One of them stood out looking at a Still’s disease patient.

It’s an interesting paper (Knabl et al) as this Still’s disease patient was known to have adverse reactions to 2 prior vaccines that required prednisone treatment. Nevertheless, he was jabbed anyway for C19 even after he had a very mild C19 infection (mild sore throat and a cough)! You’ll note his recovery from the vaccine was not mild but again required over 3 months of therapy. So much for the vaccine curing long or short covid for that matter.

This caught my attention as Still’s disease looks like it could be triggered by transfected DNA in LNPs. What does ChatGPT4.o have to say about this?

The paper goes on to describe differentially expressed genes (DEGs) between the single AOSD patient and a healthy control (I cant find the RNA-seq for the healthy controls?). So do these DEGs overlap with the cGAS-STING pathway known to be activated by cytosolic DNA?

That’s a bingo!

The hard part of this sleuthing is finding DNA sequences in a study that tried to erase them. Most RNA-seq methods use DNases, RNA purification kits and amplification with Actinomycin D which are all designed to remove DNA from the prep.

But let’s dig anyway. If you go to the SRA for this project you can use fastq-dump to pull down these 6 sequencing files. You’ll need over 64Gb+ of disk space. 4X that as you’ll need to trim the reads and map them to the Pfizer plasmid reference.

You’ll need to install the SRA-toolkit which has Fastq-dump as one of its programs. Once installed, you just need to type fastq-dump SRA[Run#] and it will download the data to your working directory.

fastq-dump SRR1831962

When this is complete, you will need to Trim the Illumina reads of their adaptors.

We use cutadapt for this.

pip install cutadapt

Once installed

cutadapt -a AGATCGGAAGAGC -o trimmed.SRR1831962.fastq SRR1831962.fastq

I tend to also remove reads with under Q20 scores and under 30bp in read length.

cutadapt -a AGATCGGAAGAGC -q 20 —minimum-length 30 -o trimmed_SRR1831962.fastq SRR1831962.fastq

Now its time to map these reads to the Pfizer reference.

If you don’t have BWA you can install it with Conda. chatGPT can help you install most of these packages.

conda install -c bioconda bwa

To map with BWA we use the below command

bwa mem -t 8 Pfizer_reference.fa trimmed_SRR1831962.fastq | samtools view -b -F 4 | samtools sort -o sorted.SRR1831962.mapped_2_Pfzr.bam

Once this is complete you need to index the BAM file with samtools so that IGV can open it. chatGPT can also help you install samtools.

samtools index sorted.SRR1831962.mapped_2_Pfzr.bam

IGV usually requires you download it straight from the Broad Institute.

You need to point it to the Pfizer reference file used for mapping using the “Load Genome Tab” and then load your BAM file using the “Load File” tab and you’ll get a display like this.

It is not surprising to find the Spike sequence (3500-7000) in RNA-Seq data post vaccination. Although, these are Buffy Coat cells so it once again DID NOT stay in the arm. What is surprising is to find 7 reads from the Pfizer vaccine DNA as they used methods to suppress this.

The pile ups of sequence at the start and stop of Spike are human UTRs that are in the Pfizer plasmid but likely recruit 5’ UTR human beta globin sequence and 3’UTR Mito sequence.

>Read 1- Day1-Shot1 (Unique)

CCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGAC

>Read 2- Day1-Shot1 (Ori)

CACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAG

>Read 3- Day1-Shot1 (Unique)

CCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGAC

>Read 4-Day0_1st Shot (AmpR)

TGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT

>Read5- Day0_1st Shot (AmpR)

TTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGA

>Read6- Day1_2nd Shot (T-Antigen→PolyA)

ATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGC

>Read7- Day 18- 2nd Shot (Ori)

GATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCAC

For some perspective, here is where a few of them land in the Pfizer plasmid. The bacterial Ori or AmpR reads may be able to wiggle out of guilt by claiming it came from a sequencing kit, but the read outside of the Ori is unique to Pfizer.

In summary, the DNA that is not supposed to be in these shots at clinically meaningful levels may in fact have a clinically meaningful impact on patients with Still’s disease. This disease has a population prevalence of 1-5 in 100,000 people.

Jonathan sent me many other projects. I’ve already found vaccine DNA contamination in 2 other projects that I am combing through now. Both are RNA-Seq projects where protocols are in place to actively suppress this signal… yet its still there… because… you know, its so miniscule even high school students at the FDA labs can find 6X-470X over the FDA limit.

Stay Tuned.