Dr. Sin Hang Lee, MD, F.R.C.P.(C), FCAP of Milford Molecular Diagnostics, obtained the Ori Primers described in McKernan et al. He then amplified and Sanger sequenced the Ori amplicon amplified from a Pfizer mRNA vial (BNT162b2).
The Ori Primers target the contaminating plasmid vector that should not be in the vaccine vials.
The origin of replication target for the MedGen qPCR primers are shown above. Primers and probes are depicted as Purple regions in the plasmid map above. Sequences of these primers and probes are published in our Preprint and depicted below.
The position in the sequence obtained by Dr. Sin Lee is depicted as blue brackets in the plasmid vector map of BNT162b2.
Bidirectional Sanger sequences of amplicons derived from the vaccine and a synthetic DNA control are show below. POP1 polymer and BigDye Terminator version 1 chemistry were used to ensure resolution of sequence adjacent to the PCR and sequencing primer sites. The same primers were used for PCR as we’re used for Sanger sequencing.
The consensus sequence for the alignment of these reads is below
>Dr.Sin_Lee_Ori.fasta
CTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGC
A BLAST against GenBank produces a 100% match for a 105bp sequence to common vectors and a 100% match for the Pfizer mRNA vector. Bold Italic text are the primers used.
Dr. Sin Lee made an important critique of using Ori primers that may lead others to generate late CT false positives. He made note that this Origin of Amplification is in many bacterial plasmids and may even be found at very low levels (CT over ~35) in some polymerase expression vectors used to make PCR kits.
Some manufacturers have learned to UV treat their polymerases which mutates this DNA into an non-amplifiable form (Thymine dimers form) without impacting the polymerase protein.
Not all manufacturers perform this patented DNA decontamination step. This trace amount of plasmids (with Ori) in qPCR kits will not deliver a CT of 20 as seen in the vaccines. But it may show in Negative Template Controls (NTCs) at late CT (>35).
This is an important contribution to the field for people planning to use these primers to look for very low levels of Ori DNA in vaccinated patient samples where the CTs are likely to be 1000 times lower (CTs in the late 30s) than in the initial vaccine (CTs in the early 20s).
Use of both Spike amplicons and Ori amplicons help to itemize this. Use of NTCs (water) in qPCR also helps to identify if this is occurring with your polymerase kit.
You will note when we used qPCR to quantitate the vaccine (in previous studies) we used both Spike and Ori amplification and they both come out right on top of each other with CTs under 20. This cannot be explained by polymerase vector contamination. Dr. Sin Lee also did not observe any bands on agarose gels with his NTC PCR with 30 cycles of amplification but could see a band on the Ori NTC with 60 cycles of PCR.

The DNaseI + and DNaseI - samples were vaccine treated with and without DNaseI. Since the bands are of similar intensity, this demonstrates that the DNA is nuclease protected in the vaccines (packaged in LNPs).
To rule out polymerase Ori contamination, it is important to confirm the Ori-amplification and sequencing results with amplification of the Spike DNA in the vaccine. The spike sequence is unique to the vaccines due to the codon optimizations they used. They are even different from the SARs-CoV-2 spike sequence and should not exist in any polymerase kits. Since the polymerases we are using only amplify DNA, it will not be confused by the spike mRNA in the vaccines.
Spike Amplicon sequence generated from the MedGen published primers by Dr. Sin Lee et al.
>Dr._Sin_Lee_Spike.fa
AGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGA
A BLAST against GenBank produces a 100% match for a 114bp Spike sequence of the Pfizer mRNA vector. Bold Italic text represent the primers used for PCR and the primer described for qPCR in previous studies. The chance of finding this by chance are 2E-50.
The sequence generated by Sanger is a perfect match the BNT162b2 spike sequence that was generated by McKernan et al. with Illumina sequencing. This aligns perfectly with the primers described and is depicted in the vector map below bracketed in light Blue.
Dr. Sin Hang Lee, MD, F.R.C.P.(C), FCAP is well known in the molecular diagnostic space for having discovered the contaminating DNA in the Gardasil vaccines. His lab is a CLIA certified diagnostic laboratory.
This is independent confirmation from a qualified CLIA laboratory that the plasmid derived dsDNA is detectable in Pfizer vials. We cannot derive quantitive assessments with this method alone as no CT scores were collected during PCR but bands were visible on agarose gels with 30 cycles of PCR.
Nevertheless, This is an important form of verification and reproduction as Sanger sequencing of PCR amplicons is considered the gold standard approach for confirming the fidelity of PCR primers. Having independent labs reproduce such results not only improves the communities confidence in the finding but also identifies other potential artifacts that may be observed upon reproduction such as the Ori primers amplifying polymerase vectors at 60 cycles.
The Pfizer and Moderna vector sequences are now in GenBank. This is an important milestone for the field as other genome projects sequencing RNA or DNA samples and comparing them against GenBank now have an annotated sequence that could describe unexpected sequence in future genomes.
Pfizer
https://ncbi.nlm.nih.gov/nuccore/OR134577.1
Moderna
https://ncbi.nlm.nih.gov/nuccore/OR134578




















First, Thank you Kevin for working with Dr Lee.
Second, To Thomas Lewis.
In 2011, an international group of concerned citizens formed an invisible collaboration with Dr Lee, in order to access Merck's Gardasil vaccines from all around the world, which was no easy feat because for whatever reason Merck chain of custody was tighter than a nuclear bomb bunker. But it had to be done, because the first samples came from only one factory, and Gardasil was made in several factories on different continents. Dr Lee needed samples from everywhere to be able to see whether it was a "one-factory" flaw or a world-wide pattern implicating the vaccine design.
The results were the same, world-wide implicating the vaccine design itself. Girls are still being damaged by Gardasil to this day, but it's "all between their ears" as well....
Because the Gardasil adjuvant was joined via the phosphate backbone, to the L1 Proteins in an unusual way, it took a long time for Dr Lee, to be able to get any results, because he had to experiment with different detection methods.
Dr Lee also obtained autopsy samples from two cases, which enabled him to perfect his methods, and go back to the vaccines and find two types he had not previously found.
These results were spread far and wide throughout the world. In the world of people keeping an eye on all the previous vaccine disasters, Dr Lee's work and his publications were well noted, fully discussed and sometimes printed in alternative media as well as discussed in videos.
Dr Lee went one step further and wrote a book about the whole tortured lies surrounding the HPV money making machine.
But who took any notice?
Gardasil was fully discussed and publicised by the Vaxxed bus
https://odysee.com/@drsuzanneh:f/Gardasil:2
https://odysee.com/@drsuzanneh:f/MERCK-S-DIRTY-LITTLE-SECRET-BY-DR-SUZANNE-HUMPHRIES:3
And the same doctor appeared on HIGHWIRE discussing Gardasil as well.
Dr Lee's observations about autopsy results here https://www.scirp.org/journal/paperinformation.aspx?paperid=25840 shows the importance of doing similar work with those who "died suddenly...
Parents all around the world know the damage that Gardasil had caused but they were all branded by the provaccine who said, "Well, nothing happened to me..." as stupid nutters.
People were not punked for believing the unbelievable.
People were punked, because for decades they did not pay attention to the real science being done in the real world, or believed all that science was conspiracy theories perpetrated by antivaxxers.
There is a very large control group existing now, who were not punked, because they paid attention.
Thank you for your putting in the time and effort to not only do what is right but to advance this much needed discussion. Your efforts and that of your colleagues doing this work will be looked upon with great respect and admiration well into the future.