miR142-3p binding site variant 3
What is this doing in the Moderna vaccine?
Much of our attention has been focused on Pfizer vaccines. This is partly because there is more disclosure via the EMA leaks on what information was exchanged with regulators for Pfizer. We don’t have this visibility on Moderna.
Pfizer has several things not seen in Moderna.
1)The Process 1 and Process 2 bait switch we believe is constrained to Pfizer
2)The SV40 sequences are unique to Pfizer
3)The 1252 amino acid spidroin ORF is unique to Pfizer.
4)Pfizer has higher DNA contamination rates
Moderna has a reverse ORF that is only 403 amino acids long and has weaker hits in UniProt (In gold on below SnapGene vector map)
But Moderna also has an interesting sequence in its 3’UTR. This is not a contaminant but included in every mRNA molecule injected (well, most mRNAs as they have lots of truncated mRNA that is likely missing the 3’ end).
If you simply Google this sequence
‘TGATAATAGGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTC’
You will find 4 Moderna patents that predate C19.
Polynucleotides encoding coagulation factor VIII.
You will also find it in the Moderna monovalent vaccine sequence published by the Fire lab so this is not a contaminant but perhaps a sequence worth discussing in light of all the coagulation problems we are seeing with these vaccines.
It is less findable in our sequence of Moderna as we sequenced Bivalent vaccines and this region of the assembly is a forced consensus of the two vaccines mRNAs. The two mRNA differ in this region and our assembly has forced them into one sequence which isn’t correct in regions where these two sequences diverge.

The patent speaks to this sequence
(miR142-3p binding site variant 3, DNA sequence)(SEQ ID NO: 122)TGATAATAGGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCTCCATAAAGTAGGAAACACTACAGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC.
The whole sequence doesn’t match to the Fire labs sequence.
There is a 23bp deletion in the Moderna sequence in pink and crossed out in the sequence above.
Given this is a miR142-3p binding site, does this sequence in the vaccine impact the concentration of cellular miR142-3p?
What does miR142-3p do? Anada-Amigo Steve Massey forwarded me this content.
and this one.
The description in the patent implies inclusion of this sequence can dampen the expression of a polypeptide.
So we have a 97bp sequence (120bp -23bp deletion) with homology to miR142-3p in the vaccine and this sequence is in a patent Moderna filed aimed at clotting hemophiliacs while literature points to it regulating colon cancer progression and being involved in neuroinflammation.
Was this disclosed to the regulators? If not, how can they deem this to be of no consequence while claiming to the USPTO that its a novel sequence with utility in clotting hemophilliacs?
So may questions…
Such little disclosure.
Does the Co-miRNA-ty conspiracy now have legs?
I guess Moderna may have Pfizer eny for that product name choice?
I have only dug into 1 of the Moderna patent but the other ones are equally deep rabbit holes. Enjoy.
For those curious minds. The Moderna 403 amino acid mystery ORF is below.
MQYQLESSCVVQFHALQHGLRIVLVELAAAATATTALQAATAAGHATQHDCDHHDGNQSGDKAQPDVPGPLDVLLVLPQFLQVDQALVQILGHLVQPIDLLLDVHHAGVDAADVAQVHVGAGVILEVLVQLLLEAVQLGLQGIVHGVVHDADHHVAVAAHEGVVGGDDLGLVEVPLGHEPVGAVAHEHALPGKVGLAVVADGWGGGEVLLLGGHVGHVQEHHSVGCALGKAHQVVALAAEVHPLALAQHALAHLGGGQVGAGPNLGGPDQLLGHVGLQALQPASDQPVDLHLGLGRVQPAQDVVQHAADGAEVAAQLLHQGVQGLGVVVHHVLQLAQGASGAAQAVLDLADGAVELVGDQLLVLVQHVLGHADAVEPVGHLHGEGDLQSGSSAESPAAGDGSG*
Amylogram doesn’t like it.
UPDATE-
Steve Massey dug deeper into this 23bp deletion and it encodes the miRNA binding site suggesting Moderna was aware of the risk (obviously, it is their patent) and took steps to mitigate it. However Maria Gutschi pointed me to some communication with EMA over Moderna changing their 3’UTR in their 4/5 bivalent vaccines which would explain why we have a mis-assembly in that part of the plasmid.
We would probably need the sequence of the original Wuhan-1 Moderna vaccine to better address the bivalent assembly.











Those MF at a clinic (IMP - internal Medical and Pediatrics) that my son went to for his biological infusion for UC gave him the Moderna shots x2. He “trusted” the CDC, FDA... He’s an adult, and didn’t discuss with me before he did it. His lot numbers were both “toxic” with high rates of SE. He spent the next almost 2 years struggling to get his symptoms under control, lost 20+lbs, developed (recurrent) cardiac symptoms which he chose to not investigate. Only “silver lining” is that he had to go on high dose steroids to control his disease, and I put him on IVM, which I suspect is why he’s still alive, and didn’t end up having surgery. he’s already at higher risk of developing colon cancer due to the UC. I detest them.
The new "safe and effective" Jibby Jabs look more like a horror show.
A nurse friend told me many, many years ago about new drugs/vaccines: "You don't want to be the first one to take it - or the last one to take it." That advice has kept me out of trouble.
Sadly, many folks had little choice because of mandates, and that's criminal.