miR142-3p binding site variant 3

What is this doing in the Moderna vaccine?

Much of our attention has been focused on Pfizer vaccines. This is partly because there is more disclosure via the EMA leaks on what information was exchanged with regulators for Pfizer. We don’t have this visibility on Moderna.

Pfizer has several things not seen in Moderna.

1)The Process 1 and Process 2 bait switch we believe is constrained to Pfizer

2)The SV40 sequences are unique to Pfizer

3)The 1252 amino acid spidroin ORF is unique to Pfizer.

4)Pfizer has higher DNA contamination rates

Moderna has a reverse ORF that is only 403 amino acids long and has weaker hits in UniProt (In gold on below SnapGene vector map)

But Moderna also has an interesting sequence in its 3’UTR. This is not a contaminant but included in every mRNA molecule injected (well, most mRNAs as they have lots of truncated mRNA that is likely missing the 3’ end).

If you simply Google this sequence

‘TGATAATAGGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTC’

You will find 4 Moderna patents that predate C19.

Polynucleotides encoding coagulation factor VIII.

You will also find it in the Moderna monovalent vaccine sequence published by the Fire lab so this is not a contaminant but perhaps a sequence worth discussing in light of all the coagulation problems we are seeing with these vaccines.

It is less findable in our sequence of Moderna as we sequenced Bivalent vaccines and this region of the assembly is a forced consensus of the two vaccines mRNAs. The two mRNA differ in this region and our assembly has forced them into one sequence which isn’t correct in regions where these two sequences diverge.

Note- This Moderna vector sequence is likely miss-assembled as it was an assembly of a bivalent vaccine. You can see an additional green ORF at noon that is actually part of the spike protein. This likely needs manual finishing which we opted not to do as it would limit people trying to reproduce our MegaHit assembly from the reads we published. This is a raw MegaHit assembly. The Pfizer 7810bp vector is more complete as we had the Pfizer monovalent vaccine sequence and RNase libraries to help resolve the assembly.

The patent speaks to this sequence

(miR142-3p binding site variant 3, DNA sequence)(SEQ ID NO: 122)TGATAATAGGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCTCCATAAAGTAGGAAACACTACAGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC.

The whole sequence doesn’t match to the Fire labs sequence.

There is a 23bp deletion in the Moderna sequence in pink and crossed out in the sequence above.

Given this is a miR142-3p binding site, does this sequence in the vaccine impact the concentration of cellular miR142-3p?

What does miR142-3p do? Anada-Amigo Steve Massey forwarded me this content.

and this one.

The description in the patent implies inclusion of this sequence can dampen the expression of a polypeptide.

So we have a 97bp sequence (120bp -23bp deletion) with homology to miR142-3p in the vaccine and this sequence is in a patent Moderna filed aimed at clotting hemophiliacs while literature points to it regulating colon cancer progression and being involved in neuroinflammation.

Was this disclosed to the regulators? If not, how can they deem this to be of no consequence while claiming to the USPTO that its a novel sequence with utility in clotting hemophilliacs?

So may questions…

Such little disclosure.

Does the Co-miRNA-ty conspiracy now have legs?

I guess Moderna may have Pfizer eny for that product name choice?

I have only dug into 1 of the Moderna patent but the other ones are equally deep rabbit holes. Enjoy.

---

For those curious minds. The Moderna 403 amino acid mystery ORF is below.

MQYQLESSCVVQFHALQHGLRIVLVELAAAATATTALQAATAAGHATQHDCDHHDGNQSGDKAQPDVPGPLDVLLVLPQFLQVDQALVQILGHLVQPIDLLLDVHHAGVDAADVAQVHVGAGVILEVLVQLLLEAVQLGLQGIVHGVVHDADHHVAVAAHEGVVGGDDLGLVEVPLGHEPVGAVAHEHALPGKVGLAVVADGWGGGEVLLLGGHVGHVQEHHSVGCALGKAHQVVALAAEVHPLALAQHALAHLGGGQVGAGPNLGGPDQLLGHVGLQALQPASDQPVDLHLGLGRVQPAQDVVQHAADGAEVAAQLLHQGVQGLGVVVHHVLQLAQGASGAAQAVLDLADGAVELVGDQLLVLVQHVLGHADAVEPVGHLHGEGDLQSGSSAESPAAGDGSG*

Amylogram doesn’t like it.

---

UPDATE-

Steve Massey dug deeper into this 23bp deletion and it encodes the miRNA binding site suggesting Moderna was aware of the risk (obviously, it is their patent) and took steps to mitigate it. However Maria Gutschi pointed me to some communication with EMA over Moderna changing their 3’UTR in their 4/5 bivalent vaccines which would explain why we have a mis-assembly in that part of the plasmid.

We would probably need the sequence of the original Wuhan-1 Moderna vaccine to better address the bivalent assembly.