Vaccine nucleic acid detected over 200 days out in blood and placenta
Sperm and seminal fluid also positive
Many thanks to VaccineMole for bringing this to our attention.
If you comb over the methods, these PCR products could be amplifying DNA, RNA or RNA:DNA hybrids. Thew New England Biolabs Monarch total RNA kits has an Optional DNaseI step and we now know that even if these authors used DNaseI, it will fail to digest the DNA.
You no longer have to wait for our PrePrint to go live to prove this to you.
David’s Speicher’s paper touched on this problem but Maria Gutchi also brought this BioNtech paper to our attention.
That 100-fold failure to digest RNA:DNA hybrids is dead on. Our next preprint will prove this to you.
But back to Milana’s great paper.
They do report 5/12 unvaccinated women (6 women with 2 tests, blood & Placenta) having PCR positivity. I do not know if this is PCR contamination or shedding but their paper did use a Pre-2020 patient as a Negative control and found no amplification. Note, these are pregnant women so their partners might have been vaccinated. I find it hard to believe shedding low levels of spike would be detectable in the recipient just due to dilution of the shed into the large volume of the recipient. PCR doesnt PCR the whole patient but only 5-50ul of the patient so the shedding dilution doesnt make sense unless they shed replication competent plasmids that could increase in copy number post shedding event…. Or contamination in the lab?
One argument against contamination is the high concordance between plasma vs placenta and Seminal fluid vs Sperm. Given the Pre-2020 sample is negative.. one would assume a PCR contaminant would be random. But the results are far from random. When you see it in blood you see in placenta. When you see it in Sperm, you see it in seminal fluid. This is 100% correlation in Blood vs Placenta. Only in the unvaccinated does it break down and the N numbers are small. Only 1/6 sample is it found in blood and not placenta. In the men, the concordance breaks down only with the men who received 1 dose or are 168 days out.
Some Sperm donors were detected later than I would have imagined (168 days) as Sperm cells turn over very quickly and sertoli cells have a blood:testis barrier to get through.
Why is this paper finding DNA and RNA longer than most other studies? Nested PCR. The Hanna paper had a LOD of 400,000 molecules which means it was designed to not find anything and Nerf the topic.
Update- The paper has been deleted? Not retracted?
This is weird? Does lead one to lean in the direction of contamination but this does not resonate with the data as presented (given its all real).
A few people have commented on the primers in this paper hitting human.
It was disclosed in the paper that 2 of their primer sets hit the UTRs in the Pfizer vaccine and that they didn’t use these primers for the spike detection.
The center spike assay had primers with some homology to human but 3/4 of these primers don’t match on the 3’end of the primer and they land on different chromosomes making amplification with PCR impossible. This is not ideal primer design but the authors claim to have Sanger sequence validated their amplicons which negates this hypothesis.
They also ran Pre-2020 patients and got zero amplification.
These data are not shown. Just spoken to so the paper should have more of these Pre-2020 NTCs and more NTCs in general to better understand the high positivity in the unvaxxed but if they truly Sanger sequence validated their amplicons then this primer gotcha is a smoke screen. The primers need to match on their 3’end and be properly orientated and <1000 bases apart for this to be a real gotcha.
1254 F CGTGATCCGGGGAGATGAAG O
1337 F ACTTCACCGGCTGTGTGATT N
1745 R TGCTGGAATGGCAGGAACTT N
1791 R GGGATCTCTAACGGCGTCTG O
Dr. McKernan, this Mordechay et al. (2025) paper is the human biodistribution smoking gun you’ve been waiting for. Your sequencing work forced the world to admit the vials contain residual plasmid DNA and SV40 promoter – contaminants regulators swore didn’t exist. Now we have the downstream reality in living people:
1> Pfizer mRNA sequences still detectable in ~50% of samples more than 200 days post-injection,
2> Sperm cells positive at 168 days despite the blood-testis barrier and rapid turnover,
3> 3 of 6 unvaccinated pregnant women positive in blood and/or placenta while pre-2020 controls remain negative.
All of this only visible because they used nested PCR. Standard qPCR – the method used in every official “no persistence” study – would have missed it entirely.
The authors note the source of the unvaccinated positives is “yet to be investigated,” but when pre-2020 controls are clean and three never-jabbed women light up, shedding is the glaringly obvious explanation.
The fact that this degree of persistence and reproductive-tissue tropism exists at all – after Pfizer and regulators swore the platform cleared in hours and “stays at the injection site” – demolishes the foundational safety narrative they sold to billions.
Your plasmid findings + their months-long mRNA persistence in placenta and germline = the complete picture no regulator ever wanted published.
They rolled this out with only 14-day rodent data and no long-term human reproductive monitoring. Whatever else this study does or doesn’t prove, it proves the “transient, local, safe” story was fraudulent from day one.
Thank you for refusing to let them bury the sequencing data. This paper lands ten times harder because of everything you’ve already forced into the open. The receipts keep stacking.
🤬 Yep horrifying… and imagine, the ACOG still wants every pregnant woman jabbed. Sincere thank you for everyone’s involvement.