It matters not what crap they put in their dodgey vials - as long as there's mRNA formulated in the poison, they don't give a sh*t. Depopulation by injection - that's their mission.
Unjabbed Mick (UK) Avoid corrupt medics sharing in Big Pharma's profit-making man-made diseases and their lucrative lethal jabs.
Trudeau does. He's had shares in a lab in BC that patented the micro encapsulation. No second thoughts for him. It makes my stomach turn everytime I imagine the sound of shiny coins thrown in his pocket every time someone got that jab.
Researchers at the University of Delhi published a preprint in January of 2020: "Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag." It was, of course, withdrawn under pressure as you can see here: http://dx.doi.org/10.1101/2020.01.30.927871. But I downloaded the preprint before it was withdrawn. They wrote about HIV inserts in C19 itself. Corresponding authors email: bkundu@bioschool.iitd.ac.in - and - vperumal@bioschool.iitd.ac.in
Picked up Pradhan, et al on 01 FEB 2020 because a friend pointed out a frothing-at-the-mouth Twitter mob slamming the paper - it was ugly. The work appeared solid to me. Went back a few days later and all the text was still there, but each page was watermarked "WITHDRAWN". A short while later and all that remained was the title and author line. Have all 3 "iterations" in my database. In light of the warp speed trashing and memory-holing of Pradhan. el, I always thought it was significant that 2 of the sponsors of bioRxiv (and medRxiv) are The Chan Zuckerberg Initiative and the Sergey Brin Family Foundation, both rich Woke thugs.
I had downloaded the papers Dr. Zhengli Shi at Wuhan and Ralph Baric proudly published in Virology and Nature Medicine, I think in 2015-16, describing how they'd taken a non-infectious bat coronavirus and made it infectious to humans, partly by adding an HIV insert. Then Fauci & Friends pretended this published, documented lab-created "chimera virus" with HIV wasn't the C19 virus circulating in Wuhan. So when Pradhan et al found an HIV insert in the C19 virus infecting the world, of course the Censor Police had to jump all over it, before anyone put two-and-two together.
I don't think that one directly admitted adding an HIV insert. But here's one that did, saying "In this study, we investigated the receptor usage of the SL-CoV S by combining a Human Immunodeficiency Virus-based pseudovirus system with cell lines expressing the ACE2 molecules of human, civet, or horseshoe bat." Here's the link: doi:10.1128/JVI.01085-07
I do, however, think it's worth noting that in the paper you cite they say, "Using the SARS-CoV reverse genetics system2, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse-adapted SARS-CoV backbone." Where "mouse-adapted" means mice whose ACE2 receptor has been altered to resemble HUMAN ACE2. So, how did they alter that "chimeric virus" using a SARS-CoV backbone so it would attach to human ACE2, and then enter the cell? I think the answer is found in the other paper. They used an HIV insert.
It raises other questions too. Over the five years, I've regularly dived into receptors. Everyone talks about ACE2 as the (only) key, but in looking at all the literature on receptors, there are so many pathways - it's not just ACE.2. Right from the Pradhan paper and then all the other sly hints, up until Cheng (preprint May 2020) and final in October 2020, where it's totally laid out, with all the other inserts... what has really bothered me has been the fact that there are actually many different receptors which result in different clinical pathologies. Those HIV inserts have to do more than just ACE2. There seems to be a spider-web sort of net throughout key points in the body and immune system. There is so much in old bioweapon literature about the relationship between rabies G8 and snake toxin sequences. There is so much in the bioweapon literature about SEB as well. Looking at the spike genetic outlay it has clear dirty paws every which way.
And when you look at all of the different facets of toxicities and inserts in the spike, and the many different possible receptor usage, in a "global" way, it seem to my pea-brain, that the construct was designed specifically to hit "everything".
Yes, ACE.2 but also other receptors in terms of which parts of the spike can create the most damage, depending on individual frailties. Even in the infection, people tended to get hit where they knew there was a vulnerability. It's almost like a receptor-selective cluster-bomb if that makes sense.
It's a concept that many are hesitant to express, but do you ever feel that while the spike itself is a pandora's box in terms of receptors, the ultimate pandora's box was the jab because LNPs coat everything - mRNA / + plasmid + SV40 + whatever else.....?
THEN to install itself, to make spike expressed from places it wouldn't go otherwise, and make the body turn against itself. And it's almost as if in some people there are sequential triggers that play out over a longer period of time.
Those smoking guns lead to the unspoken, unanswerable cluster-question of ... Who/what/when/how and why?
Even in early 2020, aka Pradhan being a first red flag there was a sense that the "sum" was so much greater than the parts, to the point where natural evolution wasn't even a possible hypothesis.
Nonetheless, the whole Tent-5 paper is a big scam. They observed a really interesting detail, but didn't address it. Instead, they played around with circular logic and completely stupid ideas.
Fauci needed people like Montagnier and Judy Mikovits to be discredited so his version of HIV and its "treatment" would reign supreme. Then he repeated the same with C19. If anyone wants the PDF of Pradhan et al's preprint of their discovery that C19 has an HIV insert, email me at my name, no punctuation, at the mail service which starts with "g". Also of interest are the articles published years earlier by "bat lady" Zhengli Shi of Wuhan and Ralph Baric, documenting how they added that HIV insert to create a coronavirus that would infect humans. I have those as well, though I'm not sure they had developed the furin cleavage site at that point, which ended up being the mechanism C19 used to enter human cells.
Yes, I remember Dr Montagnier say the viral sequence looked artificial, like it came from someone trying to develop an HIV vaccine. He died soon after he said that.
This is a lot to comprehend, even for someone with graduate level courses in Biology, particularly when those student days were a few decades ago. But I get the just of this very important article. Is RFK Jr, Dr. Makary and Dr. Bhattacharya looking at this data? Let the studies continue and the evidence pile on that mRNA “vaccines” are bad, but we have way more than enough data, already, to conclude this and to require that their use be banned immediately! Please, God, let it be. Enough of this fiasco already!
RFK is already trying to prevent that more people get injected with mRNA Covid vaccines. But it is not yet clear whether he will succeed. He is demanding a new trial whenever the mRNA Covid vaccines are updated arguing that the current vaccine is no longer covered by the initial Moderna and Pfizer trials since it has changed quite a bit. I hope that RFK can prevent that more people get harmed by being turned into spike protein producers.
In the 80's Fauci was busy killing gay men. At that time, many more people understood he was trying to kill people. Due to intense propaganda, this time around Fauci was literally worshiped by many, many people, the same people who had formerly understood who he really was. or at least knew of people who did. I look at Fauci's career and I see a serial killer. That is why I am not surprised to see his HIV vax sequence in a covid injection. Same man, same motivation.
He may be stupid or mistaken or arrogant. He might be greedy, or wrong about a lot. But I think the claim he affirmatively wants to kill people is unlikely and over the top.
To do what has been described is impossible for a "mistaken" or "stupid" person who is wrong about a lot.
Fauci is a protected species who, if he really cared about humanity in any way, shape or form, would have blown the whistle long ago, about many pathogens. The fact that he never did, is to my mind confirmation that Peter Duesberg was correct when he said that "Epidemiology (replace Fauci here if you want) is like a bikini. What is revealed is interesting, but what is concealed is crucial."
Perhaps DOGE should be let loose on this medical malpractice issue so we can follow the primaries $$$, and connections, but only if the criminals will be PROSECUTED!
It’s a depopulation scheme, pure and simple. It doesn’t matter what they put in it. They just wanted to kill us and they’ve killed many millions of people with their poison jabs. No matter what we say or how we describe it or what facts or what studies we talk about, it’s pure, simple murder. Many people are very sick now and I’m sure many of them will pass as well. The question is how many of us will remain? And now they think they can put mRNA in everything because it worked so well, so well to destroy the immune system. Anybody that takes any more jabs is hiding under a rock.
And why is the PAM sequence to make CRISPR Cas9 easier and less fatal included in the three main Co Vi D experimental jabs? Which MODeRNA sued Pfizer over. After Astrazenica bombed out?
Alamo Dude, could you please explain this a little more fully to understand what you have said? Using medical search engines, while they talk about CRISPR Cas9 in DNA vaccines there wasn't anything with the RNA ones?
Good luck researching this. A lot was scrubbed after the lawsuit by MODeRNA of Pfizer’s IP infringement. But do take notice that the DARPA-FauXi shell front company Modified RNA MODeRNA didn’t much exist before FauXi emailed them the Genomic Sequence for SARS2-Cov19 in the fall of 2019. There were mainly US tax funded research patents for parts of SARS2 going back to 2015 claimed by FauXi and Moderna.
And notice in the US and abroad, almost 100% of liability lawsuits are brought against Pfizer, not Moderna. It’s like the media blaming the Biden Administration for his Dementia cover up.
But in layman’s terms, start with the Moderna lawsuit of Pfizer. The PAM is a sequence of DNA proteins (as I understand it), that make the process of double strand DNA snip and insert editing easier, snd with less lethal outcomes. CRISPR Cas9, is one of the procedures that would ChaChing $$$ benefit possibly Trillions IF it were to some how exist inside the Human Genome. Think about it like the 60 Minutes interview with Kamala Harris. You cut out the bits you don’t want, move others around. As though TransHumanist coders who can’t even create an iOS that doesn’t need massive daily updates to debug their coding some how can code human DNA better than our Creator.
As it turns out, the sequence of proteins in the PAM doesn’t need to be exactly replicated to work. So Pfizer reversed the Moderna sequence, to end around IP infringement.
So how would one transfect this PAM into the human genome? In labs it might take thousands of years. But with a petri dish of 6-7 billion human guinea pigs being injected with transfecting potential biosynthetic modified RNA gene editing, the process would be greatly time compressed. In theory.
The odds of this PAM sequence randomly showing with out conspiracy in Moderna, Pfizer and Astrazenica is one in a Trillion.
Finally, the way Patent ownership and royalties is tracked in GMO’s is with Luciferase Quantum Dot technology. Also included in all three experimental injections.
Good luck, but over linear time, God always wins. So Pray or be prey, 🙏🙏🙏
Thank you so much for the detailed answer. So Astrazenica was taken off the market, Moderna is a FauXi bunk out, yet Pfizer appears to be favoured by TPTB.
Which leads to a whole lot of other questions doesn't it. ..... Not least of which is why is it that people are still lining up? You don't need to answer that....
By the way, when PubMed published that 🥚whites helped mitigate FauXi Flu, what happened? Cows got bird flu, but all the song birds in my trees still serenade me daily. As the price of eggs spiked in $$$, instead of spiking SARS2 spike proteins.
The vaxxed continue to claim "I'm fine." Even if they're not. Or if they're just fine for now.
Big Pharma claims they saved more lives than were lost.
Big Pharma has a blank check because of the EUA and "can't sue vaxx manufacturers."
Big Pharma has enough $$$ to pay off legislators worldwide.
So, why does this matter? It seems that the vax manufacturers can do whatever they want with whatever contaminants, and there is no pushback, regardless of how many die. They have immunity. They can do what they want.
Why are we pretending that anyone is going to hold them responsible? They're not.
Researchers at the University of Delhi published a preprint in January of 2020: "Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag." It was, of course, withdrawn under pressure as you can see here: http://dx.doi.org/10.1101/2020.01.30.927871. But I downloaded the preprint before it was withdrawn. They wrote about HIV inserts in C19 itself. Corresponding authors email: bkundu@bioschool.iitd.ac.in - and - vperumal@bioschool.iitd.ac.in
So, to give a high-level recap of your (and now subsequent others’) findings: the plasmids contaminating Pfizer can give ppl cancer, and those contaminating Moderna can give ppl HIV/AIDS. Cool, cool. :(
To add to another mystery: I remember quite early in 2020 Dr Montagnier, a specialist of AIDS and nobel prize winner was interviewed on a tv broadcast from France. He stated that upon observing the Covid virus he found a subtle cleavage of HIV in it. For him it was a human intervention, he thought it was an experiment to research a vax for AIDS. He had no clue at this point why this was done, but for sure he was 100% sure it was not natural. Soon after he was thrown under the bus as a complete ignorant, senile and uselessly interviewed. Add the vaxx HIV intervention: they had decided to kill us, quickly or slowly. We haven't seen the full extend yet of both the infection and injection.
It was put in so that Fauci can collect royalties on each jab.
Wonder who has visibility into royalty counting/payment..
It matters not what crap they put in their dodgey vials - as long as there's mRNA formulated in the poison, they don't give a sh*t. Depopulation by injection - that's their mission.
Unjabbed Mick (UK) Avoid corrupt medics sharing in Big Pharma's profit-making man-made diseases and their lucrative lethal jabs.
Trudeau does. He's had shares in a lab in BC that patented the micro encapsulation. No second thoughts for him. It makes my stomach turn everytime I imagine the sound of shiny coins thrown in his pocket every time someone got that jab.
Researchers at the University of Delhi published a preprint in January of 2020: "Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag." It was, of course, withdrawn under pressure as you can see here: http://dx.doi.org/10.1101/2020.01.30.927871. But I downloaded the preprint before it was withdrawn. They wrote about HIV inserts in C19 itself. Corresponding authors email: bkundu@bioschool.iitd.ac.in - and - vperumal@bioschool.iitd.ac.in
Picked up Pradhan, et al on 01 FEB 2020 because a friend pointed out a frothing-at-the-mouth Twitter mob slamming the paper - it was ugly. The work appeared solid to me. Went back a few days later and all the text was still there, but each page was watermarked "WITHDRAWN". A short while later and all that remained was the title and author line. Have all 3 "iterations" in my database. In light of the warp speed trashing and memory-holing of Pradhan. el, I always thought it was significant that 2 of the sponsors of bioRxiv (and medRxiv) are The Chan Zuckerberg Initiative and the Sergey Brin Family Foundation, both rich Woke thugs.
I had downloaded the papers Dr. Zhengli Shi at Wuhan and Ralph Baric proudly published in Virology and Nature Medicine, I think in 2015-16, describing how they'd taken a non-infectious bat coronavirus and made it infectious to humans, partly by adding an HIV insert. Then Fauci & Friends pretended this published, documented lab-created "chimera virus" with HIV wasn't the C19 virus circulating in Wuhan. So when Pradhan et al found an HIV insert in the C19 virus infecting the world, of course the Censor Police had to jump all over it, before anyone put two-and-two together.
Was that article this one? https://www.nature.com/articles/nm.3985
I note there is a corrigendum on it April 2016 and an authors correction in 2020..... , which is somewhat...um.. odd...
I don't think that one directly admitted adding an HIV insert. But here's one that did, saying "In this study, we investigated the receptor usage of the SL-CoV S by combining a Human Immunodeficiency Virus-based pseudovirus system with cell lines expressing the ACE2 molecules of human, civet, or horseshoe bat." Here's the link: doi:10.1128/JVI.01085-07
I do, however, think it's worth noting that in the paper you cite they say, "Using the SARS-CoV reverse genetics system2, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse-adapted SARS-CoV backbone." Where "mouse-adapted" means mice whose ACE2 receptor has been altered to resemble HUMAN ACE2. So, how did they alter that "chimeric virus" using a SARS-CoV backbone so it would attach to human ACE2, and then enter the cell? I think the answer is found in the other paper. They used an HIV insert.
I really appreciate your reply, David.
It raises other questions too. Over the five years, I've regularly dived into receptors. Everyone talks about ACE2 as the (only) key, but in looking at all the literature on receptors, there are so many pathways - it's not just ACE.2. Right from the Pradhan paper and then all the other sly hints, up until Cheng (preprint May 2020) and final in October 2020, where it's totally laid out, with all the other inserts... what has really bothered me has been the fact that there are actually many different receptors which result in different clinical pathologies. Those HIV inserts have to do more than just ACE2. There seems to be a spider-web sort of net throughout key points in the body and immune system. There is so much in old bioweapon literature about the relationship between rabies G8 and snake toxin sequences. There is so much in the bioweapon literature about SEB as well. Looking at the spike genetic outlay it has clear dirty paws every which way.
And when you look at all of the different facets of toxicities and inserts in the spike, and the many different possible receptor usage, in a "global" way, it seem to my pea-brain, that the construct was designed specifically to hit "everything".
Yes, ACE.2 but also other receptors in terms of which parts of the spike can create the most damage, depending on individual frailties. Even in the infection, people tended to get hit where they knew there was a vulnerability. It's almost like a receptor-selective cluster-bomb if that makes sense.
It's a concept that many are hesitant to express, but do you ever feel that while the spike itself is a pandora's box in terms of receptors, the ultimate pandora's box was the jab because LNPs coat everything - mRNA / + plasmid + SV40 + whatever else.....?
THEN to install itself, to make spike expressed from places it wouldn't go otherwise, and make the body turn against itself. And it's almost as if in some people there are sequential triggers that play out over a longer period of time.
Those smoking guns lead to the unspoken, unanswerable cluster-question of ... Who/what/when/how and why?
Even in early 2020, aka Pradhan being a first red flag there was a sense that the "sum" was so much greater than the parts, to the point where natural evolution wasn't even a possible hypothesis.
Aaaaaaah! there you go.
Interestingly you get a 100 percentage match for GP145 if you blast the 3'UTR:
UAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUC CCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC
https://assets.publishing.service.gov.uk/media/659e8576e96df5000df843c2/FOI_22-1004_PDF_attachment___2_.pdf
Nonetheless, the whole Tent-5 paper is a big scam. They observed a really interesting detail, but didn't address it. Instead, they played around with circular logic and completely stupid ideas.
See my critiques:
https://pubpeer.com/publications/A460C6C269ED9D3B7A96C11D15AFA3
From the start Dr Montagnier knew that about COvid-19 having an HIV cleavage. He was ridiculed to the max.
Fauci needed people like Montagnier and Judy Mikovits to be discredited so his version of HIV and its "treatment" would reign supreme. Then he repeated the same with C19. If anyone wants the PDF of Pradhan et al's preprint of their discovery that C19 has an HIV insert, email me at my name, no punctuation, at the mail service which starts with "g". Also of interest are the articles published years earlier by "bat lady" Zhengli Shi of Wuhan and Ralph Baric, documenting how they added that HIV insert to create a coronavirus that would infect humans. I have those as well, though I'm not sure they had developed the furin cleavage site at that point, which ended up being the mechanism C19 used to enter human cells.
Yes, I remember Dr Montagnier say the viral sequence looked artificial, like it came from someone trying to develop an HIV vaccine. He died soon after he said that.
Yes! he was one of the first whistleblower!
I have a hard copy somewhere also!
Share?
Can’t attach pdf here. Sorry. I have a hard copy, so I would have to turn it into pdf. That’s not allowed here.
Also a fan of the printed copy, considering the censorship weasels continued activities. Love my dropbox (haha).
I have that awesome paper in my little study about HIV in the SARS-CoV-2 virus and injection. https://shonaduncan.substack.com/i/161722134/hiv-and-the-covid-weapons
But HIV isn't the worst thing, they also put Prions in there too and I have a section about that if you scroll up https://shonaduncan.substack.com/i/161722134/prion-dementia-and-the-covid-weapons
This is a lot to comprehend, even for someone with graduate level courses in Biology, particularly when those student days were a few decades ago. But I get the just of this very important article. Is RFK Jr, Dr. Makary and Dr. Bhattacharya looking at this data? Let the studies continue and the evidence pile on that mRNA “vaccines” are bad, but we have way more than enough data, already, to conclude this and to require that their use be banned immediately! Please, God, let it be. Enough of this fiasco already!
RFK is already trying to prevent that more people get injected with mRNA Covid vaccines. But it is not yet clear whether he will succeed. He is demanding a new trial whenever the mRNA Covid vaccines are updated arguing that the current vaccine is no longer covered by the initial Moderna and Pfizer trials since it has changed quite a bit. I hope that RFK can prevent that more people get harmed by being turned into spike protein producers.
"If your soul measurement" should probably be "If your sole measurement", unless you're referring to the spiritual implications of the vaxxes.
as in a stairway to heaven
I already edited this but these hilarious comments make we want to edit it back:)
Ha ha, yeah. I think we mostly all saw that and had the same "double entendre" moment.
Yup.
In the 80's Fauci was busy killing gay men. At that time, many more people understood he was trying to kill people. Due to intense propaganda, this time around Fauci was literally worshiped by many, many people, the same people who had formerly understood who he really was. or at least knew of people who did. I look at Fauci's career and I see a serial killer. That is why I am not surprised to see his HIV vax sequence in a covid injection. Same man, same motivation.
and children in NY
He may be stupid or mistaken or arrogant. He might be greedy, or wrong about a lot. But I think the claim he affirmatively wants to kill people is unlikely and over the top.
To do what has been described is impossible for a "mistaken" or "stupid" person who is wrong about a lot.
Fauci is a protected species who, if he really cared about humanity in any way, shape or form, would have blown the whistle long ago, about many pathogens. The fact that he never did, is to my mind confirmation that Peter Duesberg was correct when he said that "Epidemiology (replace Fauci here if you want) is like a bikini. What is revealed is interesting, but what is concealed is crucial."
I'm baffled that scientists still produce papers supporting these injections, - like this Danish paper
https://papers.ssrn.com/sol3/papers.cfm?abstract_id=5227321
And they claim no conflict of interest, I don't believe it. Who at this point can in their right mind promote this crap?
" Who at this point can in their right mind promote this crap?"
It's what their betters want them to say.
It's what the $$$$$$ tells them to say.
RFK Jr?
Ouch...
This is bonkers. Just when I thought the pDNA contamination story couldn’t get worse…
Perhaps DOGE should be let loose on this medical malpractice issue so we can follow the primaries $$$, and connections, but only if the criminals will be PROSECUTED!
It’s a depopulation scheme, pure and simple. It doesn’t matter what they put in it. They just wanted to kill us and they’ve killed many millions of people with their poison jabs. No matter what we say or how we describe it or what facts or what studies we talk about, it’s pure, simple murder. Many people are very sick now and I’m sure many of them will pass as well. The question is how many of us will remain? And now they think they can put mRNA in everything because it worked so well, so well to destroy the immune system. Anybody that takes any more jabs is hiding under a rock.
And why is the PAM sequence to make CRISPR Cas9 easier and less fatal included in the three main Co Vi D experimental jabs? Which MODeRNA sued Pfizer over. After Astrazenica bombed out?
Alamo Dude, could you please explain this a little more fully to understand what you have said? Using medical search engines, while they talk about CRISPR Cas9 in DNA vaccines there wasn't anything with the RNA ones?
What Have I missed please?
Good luck researching this. A lot was scrubbed after the lawsuit by MODeRNA of Pfizer’s IP infringement. But do take notice that the DARPA-FauXi shell front company Modified RNA MODeRNA didn’t much exist before FauXi emailed them the Genomic Sequence for SARS2-Cov19 in the fall of 2019. There were mainly US tax funded research patents for parts of SARS2 going back to 2015 claimed by FauXi and Moderna.
And notice in the US and abroad, almost 100% of liability lawsuits are brought against Pfizer, not Moderna. It’s like the media blaming the Biden Administration for his Dementia cover up.
But in layman’s terms, start with the Moderna lawsuit of Pfizer. The PAM is a sequence of DNA proteins (as I understand it), that make the process of double strand DNA snip and insert editing easier, snd with less lethal outcomes. CRISPR Cas9, is one of the procedures that would ChaChing $$$ benefit possibly Trillions IF it were to some how exist inside the Human Genome. Think about it like the 60 Minutes interview with Kamala Harris. You cut out the bits you don’t want, move others around. As though TransHumanist coders who can’t even create an iOS that doesn’t need massive daily updates to debug their coding some how can code human DNA better than our Creator.
As it turns out, the sequence of proteins in the PAM doesn’t need to be exactly replicated to work. So Pfizer reversed the Moderna sequence, to end around IP infringement.
So how would one transfect this PAM into the human genome? In labs it might take thousands of years. But with a petri dish of 6-7 billion human guinea pigs being injected with transfecting potential biosynthetic modified RNA gene editing, the process would be greatly time compressed. In theory.
The odds of this PAM sequence randomly showing with out conspiracy in Moderna, Pfizer and Astrazenica is one in a Trillion.
Finally, the way Patent ownership and royalties is tracked in GMO’s is with Luciferase Quantum Dot technology. Also included in all three experimental injections.
Good luck, but over linear time, God always wins. So Pray or be prey, 🙏🙏🙏
Thank you so much for the detailed answer. So Astrazenica was taken off the market, Moderna is a FauXi bunk out, yet Pfizer appears to be favoured by TPTB.
Which leads to a whole lot of other questions doesn't it. ..... Not least of which is why is it that people are still lining up? You don't need to answer that....
🥚🥚🥚actly.
By the way, when PubMed published that 🥚whites helped mitigate FauXi Flu, what happened? Cows got bird flu, but all the song birds in my trees still serenade me daily. As the price of eggs spiked in $$$, instead of spiking SARS2 spike proteins.
Not sure I understand the message. Slightly too cryptic >oo< Edited to add, Ohhhhh ah, now I get it.... lol
I actually remembered it wrong, so much data flying around with the Faux Bird Flu. Sorry, it is egg yolks, not whites. So the Yolk is on CRT and me.
Chicken Egg Yolk Antibodies (IgYs) block the binding of multiple SARS-CoV-2 spike protein variants to human ACE2
Shuangshi Wei et al. Int Immunopharmacol. 2021 Jan.
https://pubmed.ncbi.nlm.nih.gov/33191178/
I don't know if any of this matters.
The vaxxed continue to claim "I'm fine." Even if they're not. Or if they're just fine for now.
Big Pharma claims they saved more lives than were lost.
Big Pharma has a blank check because of the EUA and "can't sue vaxx manufacturers."
Big Pharma has enough $$$ to pay off legislators worldwide.
So, why does this matter? It seems that the vax manufacturers can do whatever they want with whatever contaminants, and there is no pushback, regardless of how many die. They have immunity. They can do what they want.
Why are we pretending that anyone is going to hold them responsible? They're not.
Researchers at the University of Delhi published a preprint in January of 2020: "Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag." It was, of course, withdrawn under pressure as you can see here: http://dx.doi.org/10.1101/2020.01.30.927871. But I downloaded the preprint before it was withdrawn. They wrote about HIV inserts in C19 itself. Corresponding authors email: bkundu@bioschool.iitd.ac.in - and - vperumal@bioschool.iitd.ac.in
😉👏👏👏🎯
So, to give a high-level recap of your (and now subsequent others’) findings: the plasmids contaminating Pfizer can give ppl cancer, and those contaminating Moderna can give ppl HIV/AIDS. Cool, cool. :(
Right! Pick your poison!
He knew ….. he’s evil.
He created the harm, so only he could instantaneously charge for his created “cure(s)”.
To add to another mystery: I remember quite early in 2020 Dr Montagnier, a specialist of AIDS and nobel prize winner was interviewed on a tv broadcast from France. He stated that upon observing the Covid virus he found a subtle cleavage of HIV in it. For him it was a human intervention, he thought it was an experiment to research a vax for AIDS. He had no clue at this point why this was done, but for sure he was 100% sure it was not natural. Soon after he was thrown under the bus as a complete ignorant, senile and uselessly interviewed. Add the vaxx HIV intervention: they had decided to kill us, quickly or slowly. We haven't seen the full extend yet of both the infection and injection.