Nepetalactone Newsletter

Share this post

The Med Gen qPCR assay for assessing Pfizer and Moderna DNA contamination

anandamide.substack.com

The Med Gen qPCR assay for assessing Pfizer and Moderna DNA contamination

Anandamide
Mar 18
42
21
Share this post

The Med Gen qPCR assay for assessing Pfizer and Moderna DNA contamination

anandamide.substack.com

These qPCR primer sets have been screened against Pfizer, Moderna, and Janssen vaccines. The Spike assay is positive on all 3 vaccines. The Vector Origin primers amplify Pfizer and Moderna equally but have a ~10CT delay with Janssen (Different adenovirus vector).

Nepetalactone Newsletter is a reader-supported publication. To receive new posts and support my work, consider becoming a free or paid subscriber.

Positions of the qPCR primers on Pfizers Vector in Purple.

Primer Sets for mRNA vaccine qPCR Listed below.

Medicinal Genomics has qPCR, RT-qPCR and DNA/RNA extraction kits commercially available. These have been used on millions of tests in the cannabis industry. We are kitting these Vax specific qPCR primers for ease of ordering and ease of use but they are not on our website yet. Contact Info@medicinalgenomics.com for more information on their availability.

Spike Assay

  • MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Forward

  • >AGATGGCCTACCGGTTCA

  • MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Reverse

  • >TCAGGCTGTCCTGGATCTT

  • MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Probe

  • >/56-FAM/CGAGAACCA/ZEN/GAAGCTGATCGCCAA/3IABkFQ/

Vector Origin Assay

  • MedGen_Vax-vector_Ori_Forward

  • >CTACATACCTCGCTCTGCTAATC

  • MedGen_Vax-vector_Ori_Reverse

  • GCGCCTTATCCGGTAACTATC

  • MedGen_Vax-vector_Ori_Probe

  • /5HEX/AAGACACGA/ZEN/CTTATCGCCACTGGC/3IABkFQ/

Elute primer to 100uM according to IDT instructions.

Make 50X primer-probe mix.

  1. 25ul 100uM Forward Primer

  2. 25ul 100uM Reverse Primer

  3. 12.5ul 100uM Probe

  4. 37.5ul nuclease free ddH20.

Use 15ul of this mixture in the qPCR master mix setup seen below. (0.5ul primer/probe per reaction)

Use 10ul of this mixture in the RT-qPCR master mix setup seen below.

Medicinal Genomics Master Mix kits used

  1. https://store.medicinalgenomics.com/qPCR-Master-Kit-v3-200-rxns

  2. https://store.medicinalgenomics.com/pathoseek-rt-qpcr-master-kit

Reaction setup for 30 reactions of qPCR

  • 114ul Enzyme Mix (green tube)

  • 24ul Reaction Buffer (blue tube)

  • 246ul nuclease free ddH20

  • 15ul of Primer-Probe set Spike

  • 15ul of Primer-Probe set Ori

Use 13.8ul of above MasterMix and 5ul of purified sample (1ul Vax DNA/RNA + 4ul ddH20 if CT <15)

Reaction setup for 34 reactions of RT-qPCR

  • 200ul Enzyme mix

  • 96ul nuclease free ddH20

  • 20ul RNase Inhibitor (purple tube)

  • 4ul DTT (green tube)

  • 10ul Primer-Probe set Spike

  • 10ul Primer-Probe set Ori

10ul of MasterMix and 1ul of Vax DNA/RNA

Medicinal Genomics MIP DNA Purification Kit used

  1. https://store.medicinalgenomics.com/SenSATIVAx-DNA-Extraction-Kit-200-reactions_2

The CTAB/Chloroform/SPRI based DNA/RNA isolation methods are described in earlier posts. You will need to source your own Chloroform and Ethanol.

Cycling conditions

These conditions work for both qPCR and RT-qPCR. Note: The 50C RT step can be skipped with qPCR. The MGC qPCR MasterMix kits above have a hot start enzyme which are unaffected by this 50C step. For the sake of controlling RNA to DNA comparisons, we have put qPCR and RT-qPCR assays on the same plate and run the below program with the RT step included for all samples. We have noted that the efficiency (steeper PCR curve slope) of the Spike RT-qPCR primer set is improved with 1 minute extensions but prior published work used the below cycling conditions with 30 second extensions.

Diagram

Description automatically generated
Cycling Conditions used for qPCR and RT-qPCR

Sequences of amplicons for Positive Controls. Contact info@medicinalgenomics or order IDT gBlocks.

Ori target

Spike target

If you have additional requests for technical information- Kevin.McKernan at medicinalgenomics.com

Nepetalactone Newsletter is a reader-supported publication. To receive new posts and support my work, consider becoming a free or paid subscriber.

21
Share this post

The Med Gen qPCR assay for assessing Pfizer and Moderna DNA contamination

anandamide.substack.com
21 Comments
ClearMiddle
Writes ClearMiddle’s Clarifications
Mar 18

This is out of my field and I have no direct application for the information, but I am familiar with the basics of qPCR and primers and this fills in a good many more details about processes and answers a number of my questions. Thank you!

Expand full comment
Reply
Damian Scott
Mar 18

Thank you for sharing Ana. Since you have done testing on the actual Pfizer/Moderna vials for the DNA contamination, did you also find graphene oxidie or any self-assembly circuits inside the vials?

Expand full comment
Reply
12 replies
19 more comments…
TopNewCommunity

No posts

Ready for more?

© 2023 Anandamide
Privacy ∙ Terms ∙ Collection notice
Start WritingGet the app
Substack is the home for great writing