The Med Gen qPCR assay for assessing Pfizer and Moderna DNA contamination
These qPCR primer sets have been screened against Pfizer, Moderna, and Janssen vaccines. The Spike assay is positive on all 3 vaccines. The Vector Origin primers amplify Pfizer and Moderna equally but have a ~10CT delay with Janssen (Different adenovirus vector).
Primer Sets for mRNA vaccine qPCR Listed below.
Medicinal Genomics has qPCR, RT-qPCR and DNA/RNA extraction kits commercially available. These have been used on millions of tests in the cannabis industry. We are kitting these Vax specific qPCR primers for ease of ordering and ease of use but they are not on our website yet. Contact Info@medicinalgenomics.com for more information on their availability.
Spike Assay
>MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Forward
AGATGGCCTACCGGTTCA
>MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Reverse
TCAGGCTGTCCTGGATCTT
>MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Probe
/56-FAM/CGAGAACCA/ZEN/GAAGCTGATCGCCAA/3IABkFQ/
Vector Origin Assay
>MedGen_Vax-vector_Ori_Forward
CTACATACCTCGCTCTGCTAATC
>MedGen_Vax-vector_Ori_Reverse
GCGCCTTATCCGGTAACTATC
>MedGen_Vax-vector_Ori_Probe
/5HEX/AAGACACGA/ZEN/CTTATCGCCACTGGC/3IABkFQ/
Elute primer to 100uM according to IDT instructions.
Make 50X primer-probe mix.
25ul 100uM Forward Primer
25ul 100uM Reverse Primer
12.5ul 100uM Probe
37.5ul nuclease free ddH20.
Use 15ul of this mixture in the qPCR master mix setup seen below. (0.5ul primer/probe per reaction)
Use 10ul of this mixture in the RT-qPCR master mix setup seen below.
Medicinal Genomics Master Mix kits used
https://store.medicinalgenomics.com/qPCR-Master-Kit-v3-200-rxns
https://store.medicinalgenomics.com/pathoseek-rt-qpcr-master-kit
Reaction setup for 30 reactions of qPCR
114ul Enzyme Mix (green tube)
24ul Reaction Buffer (blue tube)
246ul nuclease free ddH20
15ul of Primer-Probe set Spike
15ul of Primer-Probe set Ori
Use 13.8ul of above MasterMix and 5ul of purified sample (1ul Vax DNA/RNA + 4ul ddH20 if CT <15)
Reaction setup for 34 reactions of RT-qPCR
200ul Enzyme mix
96ul nuclease free ddH20
20ul RNase Inhibitor (purple tube)
4ul DTT (green tube)
10ul Primer-Probe set Spike
10ul Primer-Probe set Ori
10ul of MasterMix and 1ul of Vax DNA/RNA
Medicinal Genomics MIP DNA Purification Kit used
https://store.medicinalgenomics.com/SenSATIVAx-DNA-Extraction-Kit-200-reactions_2
The CTAB/Chloroform/SPRI based DNA/RNA isolation methods are described in earlier posts. You will need to source your own Chloroform and Ethanol.
Cycling conditions
These conditions work for both qPCR and RT-qPCR. Note: The 50C RT step can be skipped with qPCR. The MGC qPCR MasterMix kits above have a hot start enzyme which are unaffected by this 50C step. For the sake of controlling RNA to DNA comparisons, we have put qPCR and RT-qPCR assays on the same plate and run the below program with the RT step included for all samples. We have noted that the efficiency (steeper PCR curve slope) of the Spike RT-qPCR primer set is improved with 1 minute extensions but prior published work used the below cycling conditions with 30 second extensions.
Sequences of amplicons for Positive Controls. Contact info@medicinalgenomics or order IDT gBlocks.
Ori target
Spike target
If you have additional requests for technical information- Kevin.McKernan at medicinalgenomics.com






Thank you for sharing Ana. Since you have done testing on the actual Pfizer/Moderna vials for the DNA contamination, did you also find graphene oxidie or any self-assembly circuits inside the vials?
This is out of my field and I have no direct application for the information, but I am familiar with the basics of qPCR and primers and this fills in a good many more details about processes and answers a number of my questions. Thank you!