The MedGen qPCR kit Update

These qPCR primer sets have been screened against Pfizer, Moderna, and Janssen vaccines. The Spike assay is positive on all 3 vaccines. The Vector Origin primers amplify Pfizer and Moderna equally but have a ~10CT delay with Janssen (Different adenovirus vector).

Primer Sets for mRNA vaccine qPCR Listed below.

Medicinal Genomics has qPCR, RT-qPCR and DNA/RNA extraction kits commercially available. These have been used on millions of tests in the cannabis industry. We are kitting these Vax specific qPCR primers for ease of ordering and ease of use but they are not on our website yet. Contact Info@medicinalgenomics.com for more information on their availability. For vaccine qPCR, a 1:10 dilution into ddH20 can be run directly in the qPCR with NO DNA PURIFICATION. This is preferred as many DNA purification kits have poor yield with 100bp fragments.

Spike Assay

• >MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Forward

• AGATGGCCTACCGGTTCA

• >MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Reverse

• TCAGGCTGTCCTGGATCTT

• >MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Probe

• /56-FAM/CGAGAACCA/ZEN/GAAGCTGATCGCCAA/3IABkFQ/

• Positive Control: tcaggctgtcctggatcttgccgatggcgctgttgaactggttggcgatcagcttctggttctcgtacagcacattctgggtcactccgatgccgttgaaccggtaggccatct

Vector Origin Assay

• >MedGen_Vax-vector_Ori_Forward

• CTACATACCTCGCTCTGCTAATC

• >MedGen_Vax-vector_Ori_Reverse

• GCGCCTTATCCGGTAACTATC

• >MedGen_Vax-vector_Ori_Probe

• /5HEX/AAGACACGA/ZEN/CTTATCGCCACTGGC/3IABkFQ/

• Positive control: gcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtag

SV40 Enhancer/Promoter

• >SV40 Enhancer/Promoter_Forward

• GTCAGTTAGGGTGTGGAAAGT

• >SV40 Enhancer/Promoter_Reverse

• GGTTGCTGACTAATTGAGATGC

• >SV40 Enhancer/Promoter_Probe

• /5TEX615/CCAGCAGGCAGAAGTATGCAAAGC/3IAbRQSp/

• positive control

• GTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAGATCGAT

These primers are now kitted at Medicinal Genomics

The RT-qPCR assay has been recently improved to use a Lyophilized RT-qPCR enzyme mix. This is better for shipping and storage (Part number 420207).

There are two vials of mastermix in this kit. Each vial should be eluted in 675ul of ddH20.

Single reaction for Spike/Ori

• 10ul RT-qPCR MasterMix

• 1ul Spike/Ori Primer Probe

• 8ul ddH20

• 1ul 1:10 diluted Vaccine.

20ul Total Reaction size.

SV40/RNAP- This assay is optional. It targets the SV40 region of Pfizer. It will not be positive on Moderna or J&J. The RNAP is the Internal Control. This can be obtained from IDT. If you are only testing vaccines, you do not need the RNAP primer probe spike. If you are testing human tissues, we advise the 0.5ul spike in for RNaseP CY5 Primer-Probe aliquot

Making the RNAP primer probe mix

• 25ul of 100uM Forward RNAP Primer

• 25ul of 100uM Reverse RNAP Primer

• 12.5ul of 100uM RNAP Probe.

• 37.5ul of ddH20

Use 0.5ul of this RNAP primer-probe aliquot for spike into the SV40/RNAP stock.

• 10ul RT-qPCR MasterMix

• 1ul SV40/RNAP Primer Probe

• 0.5ul RNAP Primer Probe (IDT)

• 7.5ul ddH20

• 1ul 1:10 diluted Vaccine.

20ul Total Reaction size.

---

qPCR- Old method (not lyophilized)

Reaction setup for 30 reactions of qPCR

• 114ul Enzyme Mix (green tube)

• 24ul Reaction Buffer (blue tube)

• 246ul nuclease free ddH20

• 30ul of Primer-Probe set Spike/Ori

Use 13.8ul of above MasterMix and 5ul of purified sample (1ul Vax DNA/RNA + 4ul ddH20 if CT <15)

If you want to run SV40/RNAP this assay should be run in its own well as the SV40 amplicon doesnt plex well with Spike/Ori.

More information on its design is here:

Sequences of amplicons for Positive Controls. Contact info@medicinalgenomics or order IDT gBlocks.

Lyophilized qPCR

This protocol makes use of the same RT-qPCR enzyme mix as the RT-qPCR process but with a 3 minute 95C heat kill step upfront to kill the RT enzyme and only target DNA.

• 10ul RT-qPCR MasterMix

• 1ul 1:10 Diluted vaccine

• 1ul Spike/Ori Primer Probe

• 8ul ddH20

20ul reaction

Ori target

Spike target

If you have additional requests for technical information- Kevin.McKernan at medicinalgenomics.com