Having suffered many months of herpes outbreaks after the first and only astra-zen jab and still suffering other adverse reactions like some autoimmune issues,and higher than normal d-dimer test results, I now understand what the astra-zen triggered these continuous outbreaks because GETTING THE ASTRAZENECA INJECTION IS LIKE BEING INJECTED WITH HERPES SIMPLEX AND SHINGLES ! The AZ also adversely affects cardiovascular blood/fluid flow to extremities, like hardening of the veins and arteries, aka microvascular clotting!
Within the Herpesviridae, CMV belongs to the Betaherpesvirinae subfamily, which also includes the genera Muromegalovirus and Roseolovirus (human herpesvirus 6 and human betaherpesvirus 7).[9] It is also related to other herpesviruses within the Alphaherpesvirinae subfamily, which includes herpes simplex viruses 1 and 2 and varicella-zoster virus, and the Gammaherpesvirinae subfamily, which includes Epstein–Barr virus and Kaposi's sarcoma-associated herpesvirus.[7]
Cytomegalovirus (CMV) is a common virus. Once infected, your body retains the virus for life. Most people don't know they have cytomegalovirus (CMV) because it rarely causes problems in healthy people.
If you're pregnant or if your immune system is weakened, CMV is cause for concern. Women who develop an active CMV infection during pregnancy can pass the virus to their babies, who might then experience symptoms. For people who have weakened immune systems, especially people who have had an organ, stem cell or bone marrow transplant, CMV infection can be fatal.
CMV spreads from person to person through body fluids, such as blood, saliva, urine, semen and breast milk.
"In addition, a construct containing a human cytomegalovirus (CMV) promoter driving a codon-optimised full length SARS-CoV-2 spike gene that has been fused to a human tissue plasminogen activator (tPA) leader sequence was then inserted into the E1 locus (van Doremalen et al., 2020b) to boost induction of an immune response."
I was more worried about the tPA leader sequence because tPA is an anti-blood-clotting protein.
The leader sequence is typically there to tell the transfected cell to treat the spike protein as though it was the anti-blood-clotting protein tPA. The cell was thus instructed to take the spike protein to the place on the blood vessel wall where the tPA usually sits. So there would be competition within the cell for the tPA's usual transport to that site, and competition on the tPA site itself. The very, very worst possible thing when the cell has just transported the pro-blood-spike protein to the blood vessel wall.
I don't know if that's how it played out in practice, but that's usual purpose for a leader sequence of that kind.
Does refusing to do the studies that would present them with the scientific evidence they so flatly deny exists equate to plausible deniability? 🙈🙉🙊 They should all be imprisoned for LIFE. Death is too easy of a way out.
I dont think Jessica Rose's data suggests this is more or less problematic compared to modRNA?
The NIH receives over $400M royalty from Moderna for their 2 proline change and is looking for 2X as much from Pfizer. I think they have influence with the FDA.
They write responses to these requesting scientists like they think they’re moronic simpletons. It’s so insulting!
I guess if regulators aren’t aware of something then it doesn’t matter.
Having suffered many months of herpes outbreaks after the first and only astra-zen jab and still suffering other adverse reactions like some autoimmune issues,and higher than normal d-dimer test results, I now understand what the astra-zen triggered these continuous outbreaks because GETTING THE ASTRAZENECA INJECTION IS LIKE BEING INJECTED WITH HERPES SIMPLEX AND SHINGLES ! The AZ also adversely affects cardiovascular blood/fluid flow to extremities, like hardening of the veins and arteries, aka microvascular clotting!
See below:
I looked up a 'CMV promoter' and found this:
https://en.m.wikipedia.org/wiki/Cytomegalovirus
Within the Herpesviridae, CMV belongs to the Betaherpesvirinae subfamily, which also includes the genera Muromegalovirus and Roseolovirus (human herpesvirus 6 and human betaherpesvirus 7).[9] It is also related to other herpesviruses within the Alphaherpesvirinae subfamily, which includes herpes simplex viruses 1 and 2 and varicella-zoster virus, and the Gammaherpesvirinae subfamily, which includes Epstein–Barr virus and Kaposi's sarcoma-associated herpesvirus.[7]
Cytomegalovirus (CMV) is a common virus. Once infected, your body retains the virus for life. Most people don't know they have cytomegalovirus (CMV) because it rarely causes problems in healthy people.
If you're pregnant or if your immune system is weakened, CMV is cause for concern. Women who develop an active CMV infection during pregnancy can pass the virus to their babies, who might then experience symptoms. For people who have weakened immune systems, especially people who have had an organ, stem cell or bone marrow transplant, CMV infection can be fatal.
CMV spreads from person to person through body fluids, such as blood, saliva, urine, semen and breast milk.
Yes. Using a CMV promoter is an obvious risk.
Our Australian drug regulator, the TGA, made no mention of the CMV promoter in its public assessment report: https://www.tga.gov.au/sites/default/files/auspar-chadox1-s-covid-19-vaccine-astrazeneca-210215.pdf
Our Australian gene technology regulator, the OGTR, who was required to assess the GMO 'vaccine' for risk, mentioned the CMV promoter but discussed no associated risks. It isn't its job to consider risk for the person actually receiving the injection - that's the job of the TGA. https://www.ogtr.gov.au/sites/default/files/2021-06/dir180-full_risk_assessment_and_risk_management_plan.pdf
"In addition, a construct containing a human cytomegalovirus (CMV) promoter driving a codon-optimised full length SARS-CoV-2 spike gene that has been fused to a human tissue plasminogen activator (tPA) leader sequence was then inserted into the E1 locus (van Doremalen et al., 2020b) to boost induction of an immune response."
I was more worried about the tPA leader sequence because tPA is an anti-blood-clotting protein.
Wow well spotted ,does explain the Thrombotic Thrombocytopenic Purpura induced by Astrazeneca.
The leader sequence is typically there to tell the transfected cell to treat the spike protein as though it was the anti-blood-clotting protein tPA. The cell was thus instructed to take the spike protein to the place on the blood vessel wall where the tPA usually sits. So there would be competition within the cell for the tPA's usual transport to that site, and competition on the tPA site itself. The very, very worst possible thing when the cell has just transported the pro-blood-spike protein to the blood vessel wall.
I don't know if that's how it played out in practice, but that's usual purpose for a leader sequence of that kind.
That said, J&J tried the tPA sequence and reported dropped it, yet they still had a blood clotting issue So... ?
Reportedly, AstraZeneca said they didn't know the cause of the clotting.
Also explains the Haemorrhagic strokes induced by Astra Zeneca
Also explains the hemorrhagic strokes induced by Astra Zeneca
The "official" document was released a year or so ago and I used it to identify the sequence match on the patent database in the last article.
It uses a "human CMV promoter" and a tPA leader sequence on the spike.
TGGACGCCATGAAGCGAGGCCTGTGCTGTGTTCTGCTTCTGTGTGGCGCCGTGTTTGTGTCCGCCAGCCAAGAGATCCACGCCAGATTTCGGAGA
Archived in note 5 here:
https://www.arkmedic.info/p/how-many-coincidences#footnote-5-144088661
Nicely confirming your sequencing.
Does refusing to do the studies that would present them with the scientific evidence they so flatly deny exists equate to plausible deniability? 🙈🙉🙊 They should all be imprisoned for LIFE. Death is too easy of a way out.
Kevin this diagram seems to indicate the presence of a tet on switch.Could you please confirm
Im not well versed on these vectors. I saw that same thing but it wasnt in my wheel house to know if its fully functional.
Why was this “vaccine” withdrawn prior to mRNA?
I dont think Jessica Rose's data suggests this is more or less problematic compared to modRNA?
The NIH receives over $400M royalty from Moderna for their 2 proline change and is looking for 2X as much from Pfizer. I think they have influence with the FDA.
This would explain why AstraZeneca never got approved in the US. Unnecessary competition with no kickbacks